<aside>
Transitioning your existing hydrolysis probe (HP)-based assays (i.e. TaqMan™ assays) from your current system to Countable PCR is straightforward. It’s possible to use an existing assay with already designed HP and primers directly on the Countable platform; however, we strongly recommend that you include probe additives (PAs) in your existing assays to achieve optimal assay performance on the Countable System.
</aside>
HPs (sometimes referred to as dual-labeled probes) carry a quencher at the 3’ end to suppress the fluorescence from the 5’ fluorophore when not incorporated by DNA polymerase. However, the quenching efficiency varies among probes, leading to inconsistent background fluorescence. On the Countable platform, background fluorescence from inefficient probe quenching reduces the ratio of signal-to-background fluorescence intensities and affects counting accuracy.
To mitigate this and ensure reliable data on the Countable platform, we strongly recommend adding a PA to your existing HP-based assay.
To design a PA, use the following guidelines:
Probe Sequence | /56-FAM/CTAGCCAGAGACATCAAGAAT/3IABkFQ/ |
---|---|
Truncated Probe | 5'-CTAGCCAGAGA-3' (Tm = 41.6 ℃) |
Reverse Complement | 5'-TCTCTGGCTAG-3' |
PA Sequence | 5'-TCTCTGGCTAG/3IABkFQ/ |